View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17426_low_5 (Length: 344)
Name: NF17426_low_5
Description: NF17426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17426_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 13721791 - 13721575
Alignment:
| Q |
20 |
tttgtcttctatagattaaaataaataagccgtgtgaaattactagcttcacaacgattcaatgattatcatttttgaactacttcactgcataaattgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13721791 |
tttgtcttctatagattaaaataaataagccctgtgaaattactagcttcacaacgattcaatgattatcatttttgaactacttcactgcataaattgt |
13721692 |
T |
|
| Q |
120 |
acaatactgagaggactgagtgaagtatgcactttctcaacaatggattcaattcagcaacgtataaaaagtatgtttttaacctttattcttcggctta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13721691 |
acaatactgagaggactgagtgaagtatgcactttctcaacaatggcttcaa-----caacgtataaaaagtatgtttttaacctttattcttcggccta |
13721597 |
T |
|
| Q |
220 |
taaaaaatagattacgcaaata |
241 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
13721596 |
tgaaaaatagattacgcaaata |
13721575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University