View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_high_21 (Length: 237)
Name: NF17427_high_21
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 88 - 219
Target Start/End: Original strand, 4623501 - 4623636
Alignment:
| Q |
88 |
atcaatgaaaatttcttttcttgaaatgggtcattgtgaattcttgagaaaagnnnnnnnnnnnnnn----atgtgggttggttgatttggttttcttat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4623501 |
atcaatgaaaatttcttttcttgaaatgggtcattgtgaatttttgaaaaaagtttttatttttattttttatgtgggttggttgatttggttttcttat |
4623600 |
T |
 |
| Q |
184 |
gcttatgttgaaaatttggtcaaattttgtgttaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623601 |
gcttatgttgaaaatttggtcaaattttgtgttaag |
4623636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University