View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_high_6 (Length: 402)
Name: NF17427_high_6
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 30 - 201
Target Start/End: Complemental strand, 26818705 - 26818534
Alignment:
| Q |
30 |
gtttgttttgtgaacttcgctattcccttgagaagcaattagagatagcagagattaaaatcaatttcagattttaccgttggcagaagttgaaaaggtt |
129 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26818705 |
gtttgttttgtgaacatcactattcccttgagaagcaagtagagatagcagagattaaaataaatttcagattttaccgttggcagaagttgaaaaggtt |
26818606 |
T |
 |
| Q |
130 |
gctaaccaacgaaatatcctttaattttaaatgaaactgtaattagcaaaggtgaaacggtatttaggccag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26818605 |
gctaaccaacgaaatatcctttaattttaaatgatactgtaattagcaaaggtgaaacggtatttaggccag |
26818534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 252 - 402
Target Start/End: Complemental strand, 26818509 - 26818357
Alignment:
| Q |
252 |
cggtactagtaagatctaatctcattcacttatgtttttatgtgtcacaactaacaaaccc--accctcactctctcgatcatgcaattttcaccatctt |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26818509 |
cggtactagtaagacctaatctcattcactcatgtttttatgtgtcacaactaacaaaccctaaccctcactctctcgatcatgcaattttcaccatctt |
26818410 |
T |
 |
| Q |
350 |
tttcacaacattatgcctcgttcaattctctatctaataggaagatattttgg |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
26818409 |
tttcacaacattatgcctcgttcaattctctatctaatagggagattttttgg |
26818357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University