View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_high_8 (Length: 395)
Name: NF17427_high_8
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_high_8 |
 | |
|
| [»] scaffold0633 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0633 (Bit Score: 128; Significance: 5e-66; HSPs: 1)
Name: scaffold0633
Description:
Target: scaffold0633; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 254 - 389
Target Start/End: Original strand, 7016 - 7151
Alignment:
| Q |
254 |
cctcgcatccatatcttgtcgggtggctcatacaagcataggactgacatgttcactggcccaccaggatatgactatagaggctgcatcaacacctcgt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7016 |
cctcgcatccatatcttgtcgggtggctcatacaagcataggactgacatgttcactagcccaccaggatatgactatagaggctgcatcaacacctcgt |
7115 |
T |
|
| Q |
354 |
cctccttccacatttgaacaaatatgaggttgcaga |
389 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7116 |
cctccttccacatttgaacgaatatgaggttgcaga |
7151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 128; Significance: 5e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 254 - 389
Target Start/End: Complemental strand, 41668210 - 41668075
Alignment:
| Q |
254 |
cctcgcatccatatcttgtcgggtggctcatacaagcataggactgacatgttcactggcccaccaggatatgactatagaggctgcatcaacacctcgt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668210 |
cctcgcatccatatcttgtcgggtggctcatacaagcataggactgacatgttcactagcccaccaggatatgactatagaggctgcatcaacacctcgt |
41668111 |
T |
|
| Q |
354 |
cctccttccacatttgaacaaatatgaggttgcaga |
389 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41668110 |
cctccttccacatttgaacgaatatgaggttgcaga |
41668075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University