View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_low_11 (Length: 381)
Name: NF17427_low_11
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 13 - 362
Target Start/End: Original strand, 12877991 - 12878340
Alignment:
| Q |
13 |
aaaatctttgcaatttaatgtgtgtttttgttttgggactgaggagtactttggtatgatctggatttgtatttggtttggggttgaaaacctgccacat |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12877991 |
aaaatctttgcaatttaatgtg--tttttgttttgggtctgaggagtactttggtatgatctggatttgtatttggtttggggttgaaaacctgccacat |
12878088 |
T |
|
| Q |
113 |
ttggcttatgtacttttggttaatggaataataataatatggtaactagtttgcttcttatattatatagttcatcttggtctctattgctacttttgag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
12878089 |
ttggcttatgtacttttggttaatggaataataataatatggtaactagtttgcttcatatattatatagttcatcttggtctctattactactgttgag |
12878188 |
T |
|
| Q |
213 |
acgaatgttaagtgaaatggagattctgttgagtttttgtaacagtaaaaggttagtgcaac--nnnnnnnnctctaaatataccagtagtgtggttaga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12878189 |
acgaatgttaagtgaaatggagattctgttgagtttttgtaacagtaaaaggttagtgcaacttttttttttctctaaatataccagtagtgtggttaga |
12878288 |
T |
|
| Q |
311 |
agtcagttagttggtacatcagacttatggaagttgctaatctggggaagta |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12878289 |
agtcagttagttggtacatcagacttatggaagttgctaatctagggaagta |
12878340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University