View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_low_16 (Length: 307)
Name: NF17427_low_16
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 158 - 301
Target Start/End: Complemental strand, 45145070 - 45144927
Alignment:
| Q |
158 |
ggacattacacgttttggtatctctccgagtagacattagtcatctctctcctgcgaacccaattattacacaaagaagcggcgtcgttttgtcctacat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45145070 |
ggacattacacgttttggtatctctccgagtagacattagtcatctctctcccgcgaacccaattattacacaaagaagcggcgtcgttttgtcctacat |
45144971 |
T |
 |
| Q |
258 |
tccagcacacgattcaaacggaataaactttccatctctgctcc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45144970 |
tccagcacacgattcaaacggaataaactttccatctcttctcc |
45144927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 39 - 78
Target Start/End: Complemental strand, 45145422 - 45145384
Alignment:
| Q |
39 |
tagaggcagatttcagattctaagctttggtaaaaaatta |
78 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45145422 |
tagaggcagatttcagattc-aagctttggtaaaaaatta |
45145384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University