View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_low_17 (Length: 293)
Name: NF17427_low_17
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_low_17 |
 |  |
|
| [»] scaffold0775 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0775 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 486 - 350
Alignment:
| Q |
1 |
tatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactagga---gaagtaggactagttgatgtgtagga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
486 |
tatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactaggagaagaagtaggactagttgatgtgtagga |
387 |
T |
 |
| Q |
98 |
cttgtttttagttttaatgttgagacatgagatagac |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386 |
cttgtttttagttttaatgttgagacatgagatagac |
350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0775; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 296 - 246
Alignment:
| Q |
188 |
acgcatgtggtaactttaagagaaaatgtatcggttgaatctaatatttat |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
296 |
acgcatgtggtaactttaagagataatgtatcggttgaatctaatatttat |
246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University