View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17427_low_35 (Length: 208)
Name: NF17427_low_35
Description: NF17427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17427_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 54183301 - 54183128
Alignment:
| Q |
18 |
attgtagttaaatgtctccttttaaatccattctcttaaatcccttaaagatcattaaagtaatattacaattaaataacatctttggttactggactgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54183301 |
attgtagttaaatgtctccttttaaatccattcttttaaatcccttaaagatcattaa-gtaatattacaattaaataacatctttggttactggactgg |
54183203 |
T |
 |
| Q |
118 |
agctaaataaattcaatttgcttatggtttgcaaattataatcaggccattggatcaactgctgtgaggggagag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54183202 |
agctaaataaattcaatttgcttatggtttgcaaattataatcaggccattggatcaactgctgtgaggggagag |
54183128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University