View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1742_high_9 (Length: 226)
Name: NF1742_high_9
Description: NF1742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1742_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 25189059 - 25188868
Alignment:
| Q |
17 |
caaaggggcaagataggcataacattggtaacaaactggttcataccacttggaaacaatagcatacccgatcaaaaggctgccaagagatcacttgatt |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25189059 |
caaaagggcaagataggcataacattggtaacaaactggttcataccacttggaaacaatagcatacccgatcaaaaggctgccaagagatcacttgatt |
25188960 |
T |
|
| Q |
117 |
tccaatttggatggtaattacaaaatccattatctagtacaagaaagtcatatatccatcttatttgaaagctattcccccaccaatatttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25188959 |
tccaatttggatggtaattacaaaatccattatctagtacaagaaagtcatatatccatcttatttgaaagctactcccccaccaatatttc |
25188868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University