View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1742_low_7 (Length: 274)
Name: NF1742_low_7
Description: NF1742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1742_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 11404185 - 11404391
Alignment:
| Q |
15 |
ggtaaccatgagatttatttatttactttggtaaatccatatat-tctctacaaaactactaag-nnnnnnnnnaactactcataataagatacgaggga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11404185 |
ggtaaccatgagatttatttatttactttggtaaatccatatatctctctacaaaactacaaagttttttttttaactactcataataagatacgaggga |
11404284 |
T |
|
| Q |
113 |
atataattctattnnnnnnnncagtttaaatgagaagaaaacggttcagatggaa-nnnnnnnnnnnatggatgagaagttaattatagcatacaatgag |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
11404285 |
atataattctatt-aaaaaaacagtttaaatgagaagaaaacggttcagatggaattttttatttttatggatgagaagttaattttagcatacaatgag |
11404383 |
T |
|
| Q |
212 |
aagaattt |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
11404384 |
aagaattt |
11404391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University