View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17431_high_16 (Length: 228)
Name: NF17431_high_16
Description: NF17431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17431_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 25 - 150
Target Start/End: Original strand, 24259365 - 24259490
Alignment:
| Q |
25 |
gtggggttgtgttggttgattgatgaaaaattgagacagcccacatggctaaatagatttgaatatgttgtaacatgttttgtatattataaagtttggt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24259365 |
gtggggttgtgttggttgattgatgaaaaattgagacagcccacatggctgaatagatttgaatatgttgtaacatgttttgtatattataaagtttggt |
24259464 |
T |
 |
| Q |
125 |
tttttgcaagacaattggatttgaga |
150 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
24259465 |
tttatgcaagacaattggatttgaga |
24259490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University