View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17431_high_4 (Length: 492)
Name: NF17431_high_4
Description: NF17431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17431_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 19 - 307
Target Start/End: Complemental strand, 47654568 - 47654280
Alignment:
| Q |
19 |
gatcatggccatggaaagtctcgtgggtttgggtatttggatttgtggtttagtgcaatgcaagctacccgaagcaaatgcggcatgttttgaaggacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47654568 |
gatcatggccatggaaagtctcgtgggtttgggtatttggatttgtggtttagtgcaatgcaagctacctgaagcaaatgcggcatgttttgaaggacaa |
47654469 |
T |
|
| Q |
119 |
caaacttcaagcgatgtggtgaacagaccagtgttctgattgtatgtttgaaagattcaagaagcattaattagagcagataaaatgtcattttgttgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654468 |
caaacttcaagcgatgtggtgaacagaccagtgttctgattgtatgtttgaaagattcaagaagcattaattagagcagataaaatgtcattttgttgaa |
47654369 |
T |
|
| Q |
219 |
gtttttggcgcatataaagtttttcatattgatttgcgttgaacatggttcataggtacgcacaagtgggtagggatggttcgtacacg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654368 |
gtttttggcgcatataaagtttttcatattgatttgcgttgaacatggttcataggtacgcacaagtgggtagggatggttcgtacacg |
47654280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 372 - 485
Target Start/End: Complemental strand, 47654285 - 47654172
Alignment:
| Q |
372 |
tacacaattatacgggcacaattgaccgaattttattaccaaacttcgtttatctatcgtttacggttgccgtttaagtttcctttcataattggttgtt |
471 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
47654285 |
tacacgattatacgggcacaattgaccgaattttattaccaaactttgtttatctattgtttacggttgccgtttaatttccctttcataattggttgtt |
47654186 |
T |
|
| Q |
472 |
gttctaacagttta |
485 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47654185 |
gttctaacagttta |
47654172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University