View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17431_low_11 (Length: 289)
Name: NF17431_low_11
Description: NF17431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17431_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 14 - 273
Target Start/End: Original strand, 7564602 - 7564861
Alignment:
| Q |
14 |
acctgtggatgcctcaattaccatggacgatagcttagtcgactgggttggtatttgattttaagtctatcacttatcttatgacttctttttctcaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7564602 |
acctgtggatgcctcaattaccatggacgatagcttagtcgactgggttggtatttgattttaagtctatcacttatcttatgacttctttttctcaatt |
7564701 |
T |
|
| Q |
114 |
aatttttgggaattacttaactgtgatatgagcaggctcgaccactattgactcgtggactcgaggaggatggaaactttagcgagttggtggatccatt |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7564702 |
aatttttgggaattactttactgtgatatgagcaggctcgaccactattgactcgtggactcgaggaggatggaaactttagcgagttggtggatccatt |
7564801 |
T |
|
| Q |
214 |
tttggaaggaaactatgatcctcaagaactcgctagaatggcagcttgcgctgctgctag |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7564802 |
tttggaaggaaactatgatcctcaagaactcgctagaatggcagcttgcgctgctgctag |
7564861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 146 - 241
Target Start/End: Complemental strand, 33144719 - 33144624
Alignment:
| Q |
146 |
caggctcgaccactattgactcgtggactcgaggaggatggaaactttagcgagttggtggatccatttttggaaggaaactatgatcctcaagaa |
241 |
Q |
| |
|
|||||||||||||| |||| ||||| | | |||||||||||||||||| || |||||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
33144719 |
caggctcgaccacttttgagtcgtgcattggaggaggatggaaactttgcagaattggtggatccatttttggaaggaaattacgatcatcaagaa |
33144624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University