View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17431_low_13 (Length: 266)
Name: NF17431_low_13
Description: NF17431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17431_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 36 - 191
Target Start/End: Complemental strand, 30404071 - 30403917
Alignment:
| Q |
36 |
aaagcctatatacaatagcattccttnnnnnnnncaggcctatatacaatagcatattttttataaaatagttatatgcacctagaatacttgtaaagaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30404071 |
aaagcctatatacaatagcattccttcaaaaaaacaggcctatatacaatagcatattttttataaaatagttatatgcacctagaattcttgtaaagaa |
30403972 |
T |
 |
| Q |
136 |
caagacattggattataacacaaattgtagagtttttgtctaactcgtaatatatt |
191 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30403971 |
caaaacatt-gattataacacaaattgtagagtgtttgtctaactcataatatatt |
30403917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 190 - 253
Target Start/End: Original strand, 16964545 - 16964608
Alignment:
| Q |
190 |
ttcttctttcttgtcttttgcaattctttttgaagaagaggaacagataaatgggttatgagtg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16964545 |
ttcttctttcttgtcttttgcaattctttttgaagaagaggaacagataaatgggttatgagtg |
16964608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University