View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_high_14 (Length: 366)
Name: NF17432_high_14
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 24 - 354
Target Start/End: Complemental strand, 5053915 - 5053585
Alignment:
| Q |
24 |
gcaactgcagtatcaaggattttgaagtctccgcaacagtattgccacggtaatataagggattttgaagcctccgcaacagtattgccactgtaatata |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5053915 |
gcaactgcagtatcaaggattttgaagtctccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgccactgtaatata |
5053816 |
T |
|
| Q |
124 |
agggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcctgcatttttctgcaatataaaggtttgcaacataactagaacca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5053815 |
agggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcccgcatttttctgcaatataaaggtttgcaacgtaactagaacca |
5053716 |
T |
|
| Q |
224 |
ctatatataatctatagttggtagtattagttttgtcaccgtcaagggacaatagtagttgtatagttttcagaaattgattcaaattctgtgatgcaaa |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5053715 |
ctatatataatctatagttggtagtattagttttgccaccgtcgagggacaatagtagttgtatagttttcagaaattgattcaaattctgtgatgctaa |
5053616 |
T |
|
| Q |
324 |
caagtgaaatgagcgctttttctgtgctgct |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5053615 |
caagtgaaatgagcgctttttctgtgctgct |
5053585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University