View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_high_19 (Length: 305)
Name: NF17432_high_19
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 87 - 296
Target Start/End: Original strand, 7584674 - 7584883
Alignment:
| Q |
87 |
gctttaagcctcacttacttttataaaattattggaccgaccctgacgtttgatgttttatgccattcattttcaatgcaaataattatgagcttcaaat |
186 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7584674 |
gctttaggtctcacttacttttataaaattattgggccgaccctgacgtttgatgtttcatgccattcattttcaatgcaaataattatgagcttcaaat |
7584773 |
T |
 |
| Q |
187 |
tattcgaatttccaactctacatgcatattgcaatgtccgtatcaagtgatttatattcacataagataattcatatcgttaactagagctatataactt |
286 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7584774 |
tattcgaattcccaaccctacatgcatattgcaatgtccgtatcaagtgatttatgttcacataacataattcatatcgttaactagagctatataactt |
7584873 |
T |
 |
| Q |
287 |
ttatagattc |
296 |
Q |
| |
|
|||||||||| |
|
|
| T |
7584874 |
ttatagattc |
7584883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 7576386 - 7576456
Alignment:
| Q |
22 |
taggagccataacggtagtcatgataaacatgctatcgtacttgggtgcaccagaactacctctagcttta |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7576386 |
taggagccataacggtagtcatgataaacatgctatcgtacttgggtgcagcagaactacctctagcttta |
7576456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 7584959 - 7585009
Alignment:
| Q |
166 |
aaataattatgagcttcaaattattcgaatttccaactctacatgcatatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7584959 |
aaataattatgagcttcaaattattcgaattcccaaccctacatgcatatt |
7585009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University