View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_high_29 (Length: 242)
Name: NF17432_high_29
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 18953712 - 18953513
Alignment:
| Q |
31 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatgaaccttgcttcctcgacagccctttcttggaagaacctggcttc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18953712 |
gcatcgcttgatccaaaacacctccatcaccctcgcccataacccttactttcatgaaccttgcttcctcgacagccctttcttggaagaacctggcttc |
18953613 |
T |
|
| Q |
131 |
cccctagacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtacggttacgttaccaactctaattatgaagagatttttctatatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18953612 |
cccctagacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgcacggttacgttaccaactctaattatgaagagatttttctatatt |
18953513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 18983759 - 18983560
Alignment:
| Q |
31 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatgaaccttgcttcctcgacagccctttcttggaagaacctggcttc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
18983759 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatgaaccttgcttcctcgacagccctttcttccaagaacctgacttc |
18983660 |
T |
|
| Q |
131 |
cccctagacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtacggttacgttaccaactctaattatgaagagatttttctatatt |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18983659 |
cccctatacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtatggttacgttaccaactctaattatgaagagatttttctatatt |
18983560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 18988561 - 18988362
Alignment:
| Q |
31 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatgaaccttgcttcctcgacagccctttcttggaagaacctggcttc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
18988561 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatcaaccttgcttcctcgacagccctttcttccaagaacctgacttc |
18988462 |
T |
|
| Q |
131 |
cccctagacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtacggttacgttaccaactctaattatgaagagatttttctatatt |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18988461 |
cccctatacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtacggttacgttaccaactctaattatgaagagatttttctatatt |
18988362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 18998405 - 18998206
Alignment:
| Q |
31 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatgaaccttgcttcctcgacagccctttcttggaagaacctggcttc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
18998405 |
gcatcgcttgatccaaaacacctccatcaccctcgccgataacccttactttcatcaaccttgcttcctcgacagccctttcttccaagaacctgacttc |
18998306 |
T |
|
| Q |
131 |
cccctagacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtacggttacgttaccaactctaattatgaagagatttttctatatt |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18998305 |
cccctatacagacgcctcgaagtagttggttcctgcaatggactgctctgcttgtagggttacgttaccaactctaattatgaagagatttttctatatt |
18998206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 18953756 - 18953726
Alignment:
| Q |
1 |
cttacattaatttatgatgatgttaagatgg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18953756 |
cttacattaatttatgatgatgttaagatgg |
18953726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 18983803 - 18983773
Alignment:
| Q |
1 |
cttacattaatttatgatgatgttaagatgg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18983803 |
cttacattaatttatgatgatgttaagatgg |
18983773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 18988605 - 18988575
Alignment:
| Q |
1 |
cttacattaatttatgatgatgttaagatgg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18988605 |
cttacattaatttatgatgatgttaagatgg |
18988575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 18998449 - 18998419
Alignment:
| Q |
1 |
cttacattaatttatgatgatgttaagatgg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18998449 |
cttacattaatttatgatgatgttaagatgg |
18998419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University