View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_low_18 (Length: 334)
Name: NF17432_low_18
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 45 - 321
Target Start/End: Complemental strand, 39296430 - 39296156
Alignment:
| Q |
45 |
ttgttaagactatcttggacaagcaatcagaataggtgattcttttttccttttatgtactcatacctaaatagaaacaaaagatgatatttgatattaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39296430 |
ttgttaagactatcttggacaagcaatcagaataggtgattcttttttccttttatgtactcatacctaaatagaaacaaa-gatgatatttgatattaa |
39296332 |
T |
 |
| Q |
145 |
gaggcacatgttcaatgtcatgcaccattttttatgaccaattagttatatattatgaatgtcagcagaaaagatttcctgctagtattggtatctctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39296331 |
gaggcacatgttcaatgtcatgcaccattttttatgaccaattagttatatattatgaatgtcagcagaaaagatttcctgctagtattggtatctctct |
39296232 |
T |
 |
| Q |
245 |
caaaaaaggcacattgctcgcttaatgcatgaatggtaacagatagattctgctttatttctgctcgcttaatattg |
321 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39296231 |
ca-aaaaggcacattgctcgcttaatgcatgaatggtaacagatagattctgctttatttctgctcgcttaatattg |
39296156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University