View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_low_22 (Length: 288)
Name: NF17432_low_22
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 15428651 - 15428380
Alignment:
| Q |
1 |
aatggacagaaacgtatgtcgctagggttagtgacactggaaattggaataaaattgattgagccattggaagacaagcagaaacgagggttggtgtgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15428651 |
aatggacagaaacgtatgtcgctagggttggtgacactggaaattggaataaaattgattgagccattggaagacaagcagaaacgagggttggtgtgat |
15428552 |
T |
 |
| Q |
101 |
tgattgtttgcatttttataataactacaattttatcacttatgattatgccattcaatcatcactctcacaaaacaacgacaaactttgcaatttggtc |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15428551 |
tgattatttgcatttttataataactacagttttatcacttatgattatgccattcaatcatcactctcacaaaacaacgacaaaccttgcaatttggtc |
15428452 |
T |
 |
| Q |
201 |
tgcagcgggtttagcgatcgtgtgtgaaataggaggggaggatcataacaacttgtgtgcctcacttatttc |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15428451 |
tgcagggggtttagcgatcgtgtgtgaaataggaggggaggatcataacaacttgtgtgcctcacttatttc |
15428380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University