View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_low_23 (Length: 278)
Name: NF17432_low_23
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 54543647 - 54543894
Alignment:
| Q |
13 |
aaaatacgcggtagatacacaccagtcagggagtggtaggccagcaaggtttgaatgttgcatccagacatttgctaagttgaagaaataaaagaacaca |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54543647 |
aaaatacgcgggagatacacaccagtcagggagtggtaggccagcaaggtttgaatgttgcatccagacatttgc-aagttgaagaaataaaagaacaca |
54543745 |
T |
 |
| Q |
113 |
aactgataagacgagaaatggaagagtacagtttcagannnnnnnggaacgtggttatataattaagtaaggtatgctgatagttttgcattggaaacag |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54543746 |
aactgataagaagagaaatggaagagtacagtttcagatttttttggaacgtggttatataattaagtaaggtatgctgatagttttgcattggaaacag |
54543845 |
T |
 |
| Q |
213 |
ctgataattattaagtagaggagaggacatgagaagagaaagagaaaga |
261 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54543846 |
ctgataattattaagtagtggagaggacatgagaagagaaagagaaaga |
54543894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University