View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_low_25 (Length: 252)
Name: NF17432_low_25
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 17431645 - 17431874
Alignment:
| Q |
1 |
ccatagtaaattttgtctgcaattctgttgtagctgttagattcagtccacaatcataagttaaaactatagttaaatcagtgataaagtttcgctttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431645 |
ccatagtaaattttgtctgcaattctgttgtagctgttagattcagtccacaatcataagttaaaactatagttaaatcagtgataaagtttcgctttta |
17431744 |
T |
 |
| Q |
101 |
cctaatttgtcacccctg-cttgtttttggagaagttctggcatttcgatgctctggtaaaatgataaaaatactttgtcggttttctgctagtttgtaa |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431745 |
cctaatttgtcacccctgccttgtttttggagaagtgctggcatttcgatgctctggtaaaatgataaaaatactttgtcggttttctgctagtttgtaa |
17431844 |
T |
 |
| Q |
200 |
cggcgttgtggtgtttaaggctgttcaaat |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
17431845 |
cggcgttgtggtgttcaaggctgttcaaat |
17431874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 98
Target Start/End: Original strand, 17430586 - 17430676
Alignment:
| Q |
7 |
taaattttgtctgcaattctgttgtagctgttagattcagtccacaatcataagttaaaactatagttaaatcagtgataaagtttcgcttt |
98 |
Q |
| |
|
||||||| | |||||||| || | |||||||||||| | ||||||||| |||| || |||| | ||||||||||||||| |||||| ||||| |
|
|
| T |
17430586 |
taaatttcggctgcaattgtggtctagctgttagatgctgtccacaattataactt-aaaccacagttaaatcagtgatgaagttttgcttt |
17430676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University