View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_low_27 (Length: 247)
Name: NF17432_low_27
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 18083422 - 18083191
Alignment:
| Q |
1 |
agtggagtagcaaaggacatgtgataatgagattctagatatgaggttatgaatgtcttaaattctcttacatttctgtgttacatagatcaatattaat |
100 |
Q |
| |
|
|||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18083422 |
agtgaagtatcaaatgacatgtgataatgagattctagatatgaggttatgaatgtcttaaattctcttacatttctgtgttacatagatcaatattaat |
18083323 |
T |
 |
| Q |
101 |
tactctattagttatacttaagttcatatattacttccggttttattggctgagctaaacaaactacgtcaaaggaattcaaaggcaataccatttctaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18083322 |
tactctactagttatacttaagttcatatattacttccggttttattggctgagctaaacaaactacgtcaaaggaattcaaaggcaataccatttctaa |
18083223 |
T |
 |
| Q |
201 |
tgtttgttattggatgttgcttgtgttcttca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18083222 |
tgtttgttattggatgttgcttgtgttcttca |
18083191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University