View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17432_low_38 (Length: 202)
Name: NF17432_low_38
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17432_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 9e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 39955734 - 39955565
Alignment:
| Q |
19 |
aatcatttatcaagtttttatttatgtccagaccaaattgtatattatcaaggtctcttttttctaaaaaccggagttaaaattgggataagtattttta |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39955734 |
aatcatttatcaaagttttatttatgtccagaccaaattgcatattatcaaggtctcttttttctaaaaaccggagttaaaattgggataagtattttta |
39955635 |
T |
 |
| Q |
119 |
ataagggaaataaatatttaatgcatgctttcttcaatttatttacnnnnnnnattaagtaattatgaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39955634 |
ataagggaaataaatatttaatgcatgctttcttcaatttatttactttttttattaagtaattatgaaa |
39955565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University