View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17434_high_37 (Length: 300)
Name: NF17434_high_37
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17434_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 51367444 - 51367171
Alignment:
| Q |
18 |
ccgatgaaccggatagaagatctggtcgggttgctaaatcgagtcagcttttgtccgggatgattgggaggaaaggtgatgatgatgaagatgatccttt |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367444 |
ccgatgaacctgatagaagatctggtcgggttgctaaatcgagtcagcttttgtccgggatgattgggaggaaaggtgatgatgatgaagatgatccttt |
51367345 |
T |
 |
| Q |
118 |
tatggaagaggattttccagatgagtataagaaaacacattttagtctctggattcttcttgaatggttgagtttgattttaattattggtgcatcagta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367344 |
tatggaagaggattttccagatgagtataagaaaacacattttagtctctggattcttcttgaatggttgagtttgattttaattattggtgcatcagta |
51367245 |
T |
 |
| Q |
218 |
acaactttttgtgttcctttgttgtgggaaaagaatctgtggcagcttaagttttggaaatgtgaagtgatgat |
291 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
51367244 |
acaactttttgtgttcctttgttgagggaaaagaaactgtggcagcttaagttgtggaaatgggaagtgatgat |
51367171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University