View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17434_high_51 (Length: 250)
Name: NF17434_high_51
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17434_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 42072358 - 42072600
Alignment:
| Q |
1 |
ctctcaacactttgttctgttctatcctctgtaacattttcatggctgcagcaacctcacaacaaccttttcaacaaaacaacaatgagcttaacagaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42072358 |
ctctcaacactttgttctgttctatcctctgtaacattttcatggctgcagcaacctcacaacaaccttttcaacaaaacaacaatgagcttaacagaca |
42072457 |
T |
 |
| Q |
101 |
agaaattcaaactgccatagctaaagcagttgagttaagagcccttcatgctgcattaactcaaggaaatagcccaagcccaagtccaggcccagctaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42072458 |
agaaattcaaactgccatagctaaagcagttgagttaagagcccttcatgctgcattaactcaaggaaatagcccaagcccaagtccaggcccagctaaa |
42072557 |
T |
 |
| Q |
201 |
gctagatttccatctccttcccctgtttctcagttctctgctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42072558 |
gctagatttccatctccttcccctgtttctcagttctctgctc |
42072600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University