View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17434_high_62 (Length: 205)

Name: NF17434_high_62
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17434_high_62
NF17434_high_62
[»] chr4 (1 HSPs)
chr4 (10-91)||(19061753-19061834)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 19061753 - 19061834
Alignment:
10 gggttgcaggaaaatagcagagaccaaatagcgatcgaaagagatcatataaatatatataaaagattgctgcatataaata 91  Q
    |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
19061753 gggttgcaggaaaatagcggagaccaaatagcgattgaaagagatcatataaatatatataaaagattgctgcatataaata 19061834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University