View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17434_low_25 (Length: 359)
Name: NF17434_low_25
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17434_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 127 - 343
Target Start/End: Complemental strand, 14244593 - 14244377
Alignment:
| Q |
127 |
tcatcatcaaatcaaatcatggttgacgaaaacgaaaactcacccttactgacttccgaaatcgaagaagaagtagaagaaatcaccaccgcaaccgcca |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14244593 |
tcatcatcaaatcaaatcatggttgacgaaaacgaaaactcacccttactgacgtccgaaatcgaagaagaagtggaagaaatcaccaccgcaaccgcca |
14244494 |
T |
|
| Q |
227 |
atgacggcgataccgcaaaacacgtccgaacaaaggtaccggaagtagagatccatttattccggcaaggaaaaggaccgattgtggtgttcaaatctgc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14244493 |
atgacggcgataccgcaaaacacgtccgaacaaaggtaccggaagtagagatccatttattccggcaaggaaaaggaccgattgtggtgttcaaatctgc |
14244394 |
T |
|
| Q |
327 |
tttaggaggttgggaac |
343 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14244393 |
tttaggaggttgggaac |
14244377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 14244714 - 14244666
Alignment:
| Q |
14 |
caaaggtcgaaggttgcgcaagaaaggaatcggagattttggtaattcc |
62 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14244714 |
caaaggttgaaggttgcgcaagaaaggaatcggagattttggtaattcc |
14244666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 14254428 - 14254382
Alignment:
| Q |
12 |
agcaaaggtcgaaggttgcgcaagaaaggaatcggagattttggtaa |
58 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
14254428 |
agcaaaggttgaagcttgcgcaagaaaggaatcgaacattttggtaa |
14254382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University