View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17434_low_37 (Length: 312)
Name: NF17434_low_37
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17434_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 47654387 - 47654280
Alignment:
| Q |
20 |
aaaatgtcattttgttgaagtttttggcgcatataaagtttttcatattgatttgcgttgaacatggttcataggtacgcacaagtgggtagggatggtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654387 |
aaaatgtcattttgttgaagtttttggcgcatataaagtttttcatattgatttgcgttgaacatggttcataggtacgcacaagtgggtagggatggtt |
47654288 |
T |
 |
| Q |
120 |
cgtacacg |
127 |
Q |
| |
|
|||||||| |
|
|
| T |
47654287 |
cgtacacg |
47654280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 192 - 305
Target Start/End: Complemental strand, 47654285 - 47654172
Alignment:
| Q |
192 |
tacacaattatacgggcacaattgaccgaattttattaccaaacttcgtttatctatcgtttacggttgccgtttaagtttcctttcataattggttgtt |
291 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
47654285 |
tacacgattatacgggcacaattgaccgaattttattaccaaactttgtttatctattgtttacggttgccgtttaatttccctttcataattggttgtt |
47654186 |
T |
 |
| Q |
292 |
gttctaacagttta |
305 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47654185 |
gttctaacagttta |
47654172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University