View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17434_low_42 (Length: 291)
Name: NF17434_low_42
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17434_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 11 - 257
Target Start/End: Original strand, 46287546 - 46287792
Alignment:
| Q |
11 |
tgaaccccaccatcaggttataaacttgatagtcactcccttgtgctctcttttaaccattctaaatatttgagattgcccccagtgatgggtaaggaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287546 |
tgaaccccaccatcaggttataaacttgatagtcactcccttgtgctctcttttaaccattctaaatatttgagattgcccccagtgatgggtaaggaga |
46287645 |
T |
 |
| Q |
111 |
tcacctctggcacactgaaaaaggataaaagtaagtggtaagaacaatgtgaatgccctgttgtccataattacacctcaattcatttcaatatggattc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287646 |
tcacctctggcacactgaaaaaggataaaagtaagtggtaagaaccatgtgaatgccctgttgtccataattacacctcaattcatttcaatatggattc |
46287745 |
T |
 |
| Q |
211 |
agtgcctaagttcttgagtcttggcagatttatagtttaagttttcc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287746 |
agtgcctaagttcttgagtcttggcagatttatagtttaagttttcc |
46287792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University