View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17434_low_47 (Length: 272)
Name: NF17434_low_47
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17434_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 52036411 - 52036155
Alignment:
| Q |
18 |
ggtagttgggaggaggacgacgaagaagctttaggccgcggtttctctgctagatatgctgcaccttcagctaaaacactcaagcaatgatataattttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52036411 |
ggtagttgggaggaggacgacgaagaagctttaggccgcggtttctctgctagatatgctgcatcttcagctaaaacactcaagcaatgatataaggttt |
52036312 |
T |
|
| Q |
118 |
atagaagtgttttcggagataacatggttttaaattacgg----------ttgctatatcttgagac--nnnnnnnngtagttaaaataatcatatggtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52036311 |
atagaagtgttttcggagataacatggttttcaattacggttcataccttttgctatatcttgagacttttttttttgtagttaaaataatcatatggtt |
52036212 |
T |
|
| Q |
206 |
gtagaaattattcatgtttgatgcatcgatggttgtattaatctgaacctgtgtata |
262 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52036211 |
gtagaaattattcatgtttgatgcatcaatggttgtattaatctgaacctgtgtata |
52036155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University