View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17435_high_13 (Length: 271)
Name: NF17435_high_13
Description: NF17435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17435_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 2608262 - 2608006
Alignment:
| Q |
1 |
aagtgtgtaagtgatgatgatgttatttgtttgtatagagaacttggatatggaatggtgatttgtagaaaagttgggaatatgggtcgatgggaatggc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2608262 |
aagtgtgtaagtgatgatgatgtaatttgtttgtatagagaacttggatatggaatggtgatttgtagaaaagttgcgaatatgggtcgatgggaatggc |
2608163 |
T |
 |
| Q |
101 |
tttgggttgatgggtgtgattacatcaaagggaaaaaagtgcttaattgtcctataagaggaatacttgttcatccaactcttgcttcttcatctatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2608162 |
tttgggttgatgggtgtgattacatcaaagggaaaaaagtgcttaattgtcctataagaggaatacttgttcatccaactcttgcttcatcatctatttt |
2608063 |
T |
 |
| Q |
201 |
cttttaaatttgaaatcatctttgggtgtgttttttagaggttttattcgtgtatga |
257 |
Q |
| |
|
|||||||||| ||||| || ||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
2608062 |
cttttaaattagaaatgatatttaggtgtgtttttgagaggttttatttgtgtatga |
2608006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University