View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17435_high_21 (Length: 236)
Name: NF17435_high_21
Description: NF17435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17435_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 66 - 219
Target Start/End: Complemental strand, 34305408 - 34305257
Alignment:
| Q |
66 |
aaataaatatgtaccgtggtaaattatttcttaggggagaacatacatgaaaccaaaaatgtaaggggggattacaaagttagtacaacatagtgtgtta |
165 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
34305408 |
aaataaatatgtaccgtgttaaattatttcttaggggagtacatacatgaaaccaaaaatgtaaggggag--tacaaagttagtacaaagtagtgtgtta |
34305311 |
T |
 |
| Q |
166 |
atatgtgcctctcaactcaactcaccattttcgtatgcttgacatgcctctttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34305310 |
atatgtgcctctcaactcaactcaccattttcgtatgcttgacatgcctctttt |
34305257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 34305467 - 34305435
Alignment:
| Q |
16 |
aaaataaaaagactataatcttattttcggtgt |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
34305467 |
aaaataaaaagactgtaatcttattttcggtgt |
34305435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University