View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17435_high_25 (Length: 206)
Name: NF17435_high_25
Description: NF17435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17435_high_25 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 938164 - 938369
Alignment:
| Q |
1 |
aacattgcctttaatgcatctggtattgtttataattgaaataagataaaggattattcgtcaaccaaatttaaacaattttcgtgaaaactttttaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938164 |
aacattgcctttaatgcatctggtattgtttataattgaaataagataaaggattattcgtcaaccaaatttaaacaattttcgtgaaaactttttaaac |
938263 |
T |
|
| Q |
101 |
ggttaaaacagttcaaatagccggttaattaagtttagcagactattaagggatatacctcgtggttaataagttgcattagtagttaataagttttgca |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
938264 |
ggttaaaacagttcaaatagccgtttaattaagtttagcagacgattaagggatatacctcgtggttaataagttgcattagtagttaataagttttgca |
938363 |
T |
|
| Q |
201 |
acctta |
206 |
Q |
| |
|
|||||| |
|
|
| T |
938364 |
acctta |
938369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University