View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17435_low_22 (Length: 232)
Name: NF17435_low_22
Description: NF17435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17435_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 39275400 - 39275604
Alignment:
| Q |
20 |
ccataaccatgaggcttaatcctgttgttattattgtatccatatggattagcatagtgaacatctcctccatatgttccatgacgctcatatctcatct |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39275400 |
ccatgaccatgaggcttaatcctgttgttattattgtatccatatggattagcatagtgaacatctcctccatatgttccatgacgctcatatctcatct |
39275499 |
T |
|
| Q |
120 |
catccatcttactcgcgccagaaccaacacgctcctccttataagcttcaaactcatactcctcatgctctgagacatagtcattgtggccaccaccatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39275500 |
catccatcttactcgcgccagaaccaacacactcctccttgtaagcttcaaactcatactcctcatgctctgagacatagtcattgtggccaccaccatg |
39275599 |
T |
|
| Q |
220 |
atgat |
224 |
Q |
| |
|
||||| |
|
|
| T |
39275600 |
atgat |
39275604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University