View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17435_low_26 (Length: 203)
Name: NF17435_low_26
Description: NF17435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17435_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 4770439 - 4770612
Alignment:
| Q |
18 |
atttcttcccttaccaattgtagttgaagtttatcaagagtttgtcttagatcagatagaagttctggtcgataatcgcagctgatagatgctttgtaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4770439 |
atttcttcccttaccaattgtagttgaagtttatcaagagtttgtcttagatcagatagaagttctggtcgataatcgcagctgatagatgctttgtaaa |
4770538 |
T |
 |
| Q |
118 |
gaaatgatccaccattttcatatggttcaactttcacttcatcgtcatctgttgggattgaataacctttgctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
4770539 |
gaaatgatccaccattttcatatggttcaactttcacttcatcatcgtctgttggaattgaataacctttgctt |
4770612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University