View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17437_high_23 (Length: 241)
Name: NF17437_high_23
Description: NF17437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17437_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 43396664 - 43396781
Alignment:
| Q |
1 |
ggtggtgcctgtgatgaatgtgaagagaagtgatatgtgtaagcttaagcaagctgcatggttgtttcatcatgctggtcttgatgctacttcattgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396664 |
ggtggtgcctgtgatgaatgtgaagagaagtgatatgtgtaagcttaagcaagctgcatggttgtttcatcatgctggtcttgatgctacttcattgctc |
43396763 |
T |
 |
| Q |
101 |
ttcactgatgaggtcaca |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43396764 |
ttcactgatgaggtcaca |
43396781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 43396843 - 43396904
Alignment:
| Q |
180 |
gttctataaataaaatttgggggaccaatttagtctccgagaagaaataataccaaactagt |
241 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396843 |
gttctataaataaaatttggcggaccaatttagtctccgagaagaaataataccaaactagt |
43396904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University