View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17437_high_6 (Length: 369)
Name: NF17437_high_6
Description: NF17437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17437_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 351
Target Start/End: Original strand, 33519379 - 33519714
Alignment:
| Q |
16 |
aaaagaaaatggctatatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgagtaccctgctgata |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519379 |
aaaagaaaatggctctatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgagtaccctgctgata |
33519478 |
T |
 |
| Q |
116 |
tgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatcaataactacggggc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519479 |
tgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatcaataactacggggc |
33519578 |
T |
 |
| Q |
216 |
tctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaacaggaatgagagatggcattcca |
315 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
33519579 |
tctctatgccaaggattgctacctctctacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaactgggatgagagatggcattcca |
33519678 |
T |
 |
| Q |
316 |
attggtgatcaggtactcatatgtagtccaactgtt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519679 |
attggtgatcaggtactcatatgtagtccaactgtt |
33519714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 72 - 349
Target Start/End: Complemental strand, 33496521 - 33496244
Alignment:
| Q |
72 |
aaggttactagatcccctagtttttggcgagtaccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctc |
171 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || |||||| | | |||| | ||||||||||| ||| |
|
|
| T |
33496521 |
aaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgccaaagatctctacgaaggagaagagtctc |
33496422 |
T |
 |
| Q |
172 |
ctaagaggcagcctggacttcattggcatcaataactacggggctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaa |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| || ||||| ||||||||||||| |
|
|
| T |
33496421 |
ctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctctacttgtccactcgaggcagctcgtccaa |
33496322 |
T |
 |
| Q |
272 |
taaaaggctttttgcaaacaacaggaatgagagatggcattccaattggtgatcaggtactcatatgtagtccaactg |
349 |
Q |
| |
|
||| ||||||| || ||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33496321 |
taagaggctttctggaaacaactgggatgagagatggcattccaattggtgatcaggtactcgtatgtagtccaactg |
33496244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University