View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17437_low_3 (Length: 442)
Name: NF17437_low_3
Description: NF17437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17437_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 202 - 430
Target Start/End: Original strand, 2703207 - 2703429
Alignment:
| Q |
202 |
ctaaaataccatgtttaaaatatggaccgtttgattttgattcaactgccaccaaagtgcaaactacatgaatatgtgcgatttgtgaccatagacaatt |
301 |
Q |
| |
|
||||||||||| | |||||||||||| ||||||||||||| |||| ||||||| ||||||| || |||| | |||||| ||| ||||| || ||| |
|
|
| T |
2703207 |
ctaaaataccaagattaaaatatggattgtttgattttgatccaacgaccaccaatatgcaaacaac--gaatgtatgcgatatgttaccattgaagatt |
2703304 |
T |
|
| Q |
302 |
caaatccatatttgatggcctataaataattaacaaagaaaaaggtataagcaagtggtt-ctataccatgctggtgttctttgcttttctcctgatcta |
400 |
Q |
| |
|
||||||||||||||||| | | | | || ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2703305 |
caaatccatatttgatgacatgtgatcaa-----aaagaaaaaagtataagcaagtggttactataccatgctggtgttctttgcttttctcctgaccta |
2703399 |
T |
|
| Q |
401 |
gttggaaggtcaccaccacaatagatattg |
430 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
2703400 |
gttggaaggccaccaccacaatagatattg |
2703429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 2702239 - 2702278
Alignment:
| Q |
1 |
cacagataatgaattccatgtaaaaattattttaaaccta |
40 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2702239 |
cacacataatgaattccatgtaaaaattattttaaaccta |
2702278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University