View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17439_low_15 (Length: 289)
Name: NF17439_low_15
Description: NF17439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17439_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 4154805 - 4155068
Alignment:
| Q |
18 |
aatttatgatatgattcttaattcccattgatgttaattttattcttgtgatttatttatgttaatttaaatttgagccattgagggacgacaattgttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4154805 |
aatttatgatatgattcttaattcccatttatgttaattttattcttgtgaattatttatgttaatttaaatttgagccattgagggacgacaattgttt |
4154904 |
T |
 |
| Q |
118 |
ctccaaaatgtcttcttaatcttttttaattttcaattaacnnnnnnnattgttatttaattgcaagtaagtaattataaacatagattcttaaaacaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4154905 |
ctccaaaatgtcttcttaatcttttttaattttcaattaactttttttattgttatttaattgcaagtaagtaattataaacatagattcttaaaacaat |
4155004 |
T |
 |
| Q |
218 |
taggattttattggtggtcatgattcatatctaaatttttgtttgccatgagtcgagtataatc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4155005 |
taggattttattggtggtcatgattcatatctaaatttttgtttgccatgagtcgagtataatc |
4155068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 110 - 158
Target Start/End: Original strand, 4152880 - 4152929
Alignment:
| Q |
110 |
aattgtttctccaaaatgtcttcttaatc-ttttttaattttcaattaac |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
4152880 |
aattgtttctccaaaatgtctttttaatctttttttaattttccattaac |
4152929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University