View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17439_low_17 (Length: 265)
Name: NF17439_low_17
Description: NF17439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17439_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 4774752 - 4774870
Alignment:
| Q |
17 |
ctggagaaacatttcgcaggagataatctcttccccttacttaaatgcatcaatgtctttcttttaagaatcgatatcaatttttgtttacggaacaata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774752 |
ctggagaaacatttcgcaggagataatctcttccccttacttaaatgcatcaatgtctttcttttaagaatcgatatcaatttttgtttacggaacaata |
4774851 |
T |
|
| Q |
117 |
aaataaaccgtttccttca |
135 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4774852 |
aaataaaccgtttccttca |
4774870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 207 - 265
Target Start/End: Original strand, 4774941 - 4774999
Alignment:
| Q |
207 |
tttggggttaataccttaaataaacactaatttagcaatgactgattttcttaaaaggc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774941 |
tttggggttaatatcttaaataaacactaatttagcaatgactgattttcttaaaaggc |
4774999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University