View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1743_high_11 (Length: 230)
Name: NF1743_high_11
Description: NF1743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1743_high_11 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 62 - 230
Target Start/End: Complemental strand, 49547588 - 49547421
Alignment:
| Q |
62 |
gttagtggtttatgattattgattgcacttctcatattttcatacttttctgcagttattatgaccnnnnnnnnnnnnngctgtatatatatttctact- |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49547588 |
gttagtggtttatgattattgattgcacttctcatattttcatacttttctgcagttattatga----tttttttttttactgtatatatatttctacta |
49547493 |
T |
|
| Q |
161 |
--gtttgtggtaatttagagactaatttgatcaagctttgtgcaattaattgatggattaagttgggtcact |
230 |
Q |
| |
|
|| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49547492 |
ctgtatgcggtaatttagagactaatttgatcaaactttgtgcaattaattgatggattaagttgggtcact |
49547421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 118
Target Start/End: Complemental strand, 49444191 - 49444123
Alignment:
| Q |
50 |
ttgagaccactggttagtggtttatgattattgattgcacttctcatattttcatacttttctgcagtt |
118 |
Q |
| |
|
|||||||||||||||||| |||||| | |||| |||| | ||||||||| || || ||||||||||||| |
|
|
| T |
49444191 |
ttgagaccactggttagtagtttatcactattcattgtaattctcatatcttgatgcttttctgcagtt |
49444123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 105
Target Start/End: Complemental strand, 44261909 - 44261863
Alignment:
| Q |
59 |
ctggttagtggtttatgattattgattgcacttctcatattttcata |
105 |
Q |
| |
|
||||||||| |||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
44261909 |
ctggttagtagtttatcattattcattgcacttctcatatgttcata |
44261863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 98
Target Start/End: Original strand, 47872306 - 47872342
Alignment:
| Q |
62 |
gttagtggtttatgattattgattgcacttctcatat |
98 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
47872306 |
gttagtagtttatgattattcattgcacttctcatat |
47872342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University