View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1743_low_6 (Length: 416)
Name: NF1743_low_6
Description: NF1743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1743_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 7 - 397
Target Start/End: Complemental strand, 27923329 - 27922939
Alignment:
| Q |
7 |
tagataatacttagcttacaagagttttgaggcattcaaatgtaatttcaaatttggagagttccagtgcccattttgtcattttctaggcaaaatctgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27923329 |
tagataatacttagcttacaagagttttgaggcattcaaatgtaatttcgaatttggagagttccagtgcccattttgtcatttgctaggcaaaatctgg |
27923230 |
T |
|
| Q |
107 |
tatgaataacatgtgtttaatgggttggttaatccacaccacagtagggtaggccatgaagtctcgacaaagctttctcgtaggtgtcatcagggctaag |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27923229 |
tatgaacaacatgtgtttaatgggttggttaatccacaccacagtagggtaggccatgaagtctcgacaaagctttcttgtaggtatcatcagggctaag |
27923130 |
T |
|
| Q |
207 |
gcaaccttttcgattttttgtcttacctcggtccctttgagtactttgttcataaagtatacctagtgttgggtttcatcgtccttcctggttaggacaa |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27923129 |
gcaaccttttcgattttttgtcttacctcggtccctttgagtactttgttcataaagtatacctagtgttgggtttcatcgtcctccctggttaggacaa |
27923030 |
T |
|
| Q |
307 |
cactggcttccttttttgaaacaactatataaacaaattgtttctctatggggtccagtcttgaaattatcgggagttgagattgaacttt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27923029 |
cactggcttccttttttgaaacaactatataaacaaattgtttctctatggggtccagtcttgaaattatcgggggttgagattgaacttt |
27922939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University