View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1744-Insertion-2 (Length: 172)
Name: NF1744-Insertion-2
Description: NF1744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1744-Insertion-2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 8e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 8e-72
Query Start/End: Original strand, 8 - 148
Target Start/End: Complemental strand, 40078115 - 40077975
Alignment:
| Q |
8 |
aatgaaacttttgattactattaaaataaagttacattttggtcttgtaccaagagatatggtgtagaataacattatgttccaatgaaaccatctagga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40078115 |
aatgaaacttttgattactattaaaataaagttacattttggtcttgtaccaagagatatggtgtagaataacattatgatccaatgaaaccatctagga |
40078016 |
T |
 |
| Q |
108 |
agtacttttattaattaaatgctaatatcatcatcatcttc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40078015 |
agtacttttattaattaaatgctaatatcatcatcatcttc |
40077975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University