View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17440_high_7 (Length: 284)
Name: NF17440_high_7
Description: NF17440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17440_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 274
Target Start/End: Complemental strand, 32942469 - 32942213
Alignment:
| Q |
18 |
acccatgcccaaacatatcaaatgtccctgcaagtgtttaccatgagttacatatgggactgtacttatgggacaatgataagcacttcactttaaatgg |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32942469 |
acccatgcccgaacatatcaaatgtccctgcaagtgtttaccatgagttacatatgggactgtacttatgggacaatgataagcacttcactttaaatgg |
32942370 |
T |
|
| Q |
118 |
atgtacttgtgatggaaatgaaacagtaggcttattcttcatctgcttgttccagttctattatgttcttctatcattgttacaattgttgttttggctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32942369 |
atgtacttgtgatggaaatgaaacagtaggcttattctttatctgcttgttccagttctattatgttcttctatcattgttacaattgttgttttggctt |
32942270 |
T |
|
| Q |
218 |
ttcacagctttgttttctcctttgttgtaggaatgaggttgtgatttcatattcata |
274 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32942269 |
ttcacagctttgttttctcttttgttgtaggaatgaggttgtgatttcatattcata |
32942213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University