View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_high_22 (Length: 385)
Name: NF17441_high_22
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 5 - 370
Target Start/End: Original strand, 397004 - 397369
Alignment:
| Q |
5 |
acctaactgtgcatatatttctctgcagcgcaagtcactgttggaagttatcaaagagacagtattatcacatctaactaaaaaatgcccaccccaggta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
397004 |
acctaactgtgcatatatttctctgcagcgcaagtcactgttggaagttatcaaagagacagtattatcacatctaactaaaaaatgcccaccccaggta |
397103 |
T |
 |
| Q |
105 |
aggaacttctctgagccacttcttgaacacttctctgattgattccaagttgtataccaatgtgatatgaattgttcttctctgatttcaccttcatctt |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
397104 |
aggaacttctctgagccacttcatgaacacttctctgattggttccaagttgtataccaatgtgatatgaatcgttcttctctgatttcaccttcatctt |
397203 |
T |
 |
| Q |
205 |
ttaggttcaagtaattggtcttctatgtagaactcccaaaaaggaaagtagatatgaattgttgcgccgagttgcagctggtggaggtttatttaaaggc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
397204 |
ttaggttcaagtaattggtcttctatgtagaactcccaaaaaggaaagtagatatgaattgttgcgccgagttgcagctggtggaggtttatttaaaggc |
397303 |
T |
 |
| Q |
305 |
gagaatgacctgaagattcatatcccaggggcaaatctaaatgacatagctaaccaggctgatgat |
370 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
397304 |
gagaatgacttgaagattcatatcccaggggcaaatctaaatgacatagctaaccaggctgatgat |
397369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University