View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_high_30 (Length: 344)
Name: NF17441_high_30
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 11 - 328
Target Start/End: Complemental strand, 48883428 - 48883111
Alignment:
| Q |
11 |
cacagacgtgacgtggcagaatcacctccctccaaatcacatactcccatgggacccaactatccccacttcattgaccaaaacaaccaatggtattccc |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883428 |
cacagacgtgacgtggcaaaatcacctccctccaaatcacatactcccatgggacccaactatccccacttcattgaccaaaacaaccaatggtattccc |
48883329 |
T |
 |
| Q |
111 |
actgtagttcatctccacggtggaattcatgaacccgaaagcgatggtaacccaaactcatttttcaccgctggattcaaaatcaagggacccacttgga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883328 |
actgtagttcatctccacggtggaattcatgaacccgaaagcgatggtaacccaaactcatttttcaccgctggattcaaaatcaagggacccacttgga |
48883229 |
T |
 |
| Q |
211 |
caaaaaagtcatatcactatccaaataatcaacaccctggaaatttatggtaccatgaccatgctatgggtttgaccagagtcaaccttctagctggctt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883228 |
caaaaaagtcatatcactatccaaataatcaacaccctggaaatttatggtaccatgaccatgctatgggtttgaccagagtcaaccttctagctggctt |
48883129 |
T |
 |
| Q |
311 |
aattgggacctacatcat |
328 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48883128 |
aattgggacctacatcat |
48883111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University