View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_high_38 (Length: 251)
Name: NF17441_high_38
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 45968166 - 45968010
Alignment:
| Q |
14 |
aaaatgtcaatggataagtataggaagagaaaatgtttacattgagggccaagattctatttctcgccgcagaatccctactgttcaaatttcttc-nnn |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45968166 |
aaaatgtcaatggataagtataggaagagaaaatgtttacattgagggccaagattctatttctcgccgcataatccctactgttcaaatttcttctttt |
45968067 |
T |
|
| Q |
113 |
nnnngcccatttagcaaacaacttattttagattttgtggtgaatcatccggatcta |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45968066 |
ttttgcccatttggcaaacaacttattttagattttgtggtgaatcattcggatcta |
45968010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 167 - 251
Target Start/End: Complemental strand, 45967973 - 45967888
Alignment:
| Q |
167 |
ctacactttcatgctaaaattgttttacatataaacaaatataattacccaacgtaataaaaga-tttatgtaaccgtcattgttt |
251 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
45967973 |
ctacactttcatggtaaaattgttttacatataaacaaatacaattccccaacgtaataaaagattttatgtacccgtcattgttt |
45967888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University