View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17441_high_43 (Length: 237)

Name: NF17441_high_43
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17441_high_43
NF17441_high_43
[»] chr7 (2 HSPs)
chr7 (3-221)||(36717744-36717956)
chr7 (37-147)||(1483018-1483129)


Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 36717744 - 36717956
Alignment:
3 tttctgagaggaagcgtggaaggaaagtgtagctgtgtagatgtatgcatggttgggtaagggttattgggagttgctgggcaaaatgtgtattgaatca 102  Q
    |||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
36717744 tttctgagaggaagcgtggaaggaaagtgtagctgtgta------tgcatggttgggtaagggtttttgggagttgctgggcaaaatgtgtattgaatca 36717837  T
103 aatcaatgtgtaggatttaaggttaagggtttctgggagttgctatcaaactagtgtgtaggaatttgggggtaaacttgatttaaagagaagcaaaaat 202  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36717838 aaccaatgtgtaggatttaaggttaagggtttctgggagttgctatcaaactagtgtgtaggaatttgggggtaaacttgatttaaagagaagcaaaaat 36717937  T
203 gtttcagctgagtgcaaat 221  Q
    ||||||||||||| |||||    
36717938 gtttcagctgagtacaaat 36717956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 37 - 147
Target Start/End: Original strand, 1483018 - 1483129
Alignment:
37 gtgtagatgtatgcatggttgggtaagggttattgggagttgctgggcaaaatgtgtattgaatcaaatcaatgtgtaggatttaagg-ttaagggtttc 135  Q
    |||||| ||||||||||||  | ||| |||| | ||||||||||||| |||||||| |||||| ||||| | |||||||||||||||| ||| |||||||    
1483018 gtgtaggtgtatgcatggtcagctaatggttttagggagttgctgggtaaaatgtgcattgaaccaaattagtgtgtaggatttaaggattaggggtttc 1483117  T
136 tgggagttgcta 147  Q
    ||||||||||||    
1483118 tgggagttgcta 1483129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University