View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_high_45 (Length: 229)
Name: NF17441_high_45
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 35417695 - 35417891
Alignment:
| Q |
17 |
atgaaggaaaaaacaagagaataagaggaaggtatgagtttgttggcaaatagttttagcaacaaaaataaacaaatatgggatttgtaggaaggaggag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417695 |
atgaaggaaaaaacaagagaataagaggaaggtatgagtttgttggcaaatagttttagcaacaaaaataaacaaatatgggatttgtaggaaggaggag |
35417794 |
T |
 |
| Q |
117 |
taagttataattttgttagagggctttgtttgtgttgggattttgtttttctcccaaacccaattattgaagggaatgggaaagacagagtagaaat |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417795 |
taagttataattttgttagagggttttgtttgtgttgggattttgtttttctcccaaacccaattattgaagggaatgggaaagacagagtagaaat |
35417891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University