View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17441_low_21 (Length: 390)
Name: NF17441_low_21
Description: NF17441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17441_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 28177518 - 28177825
Alignment:
| Q |
1 |
gagaacaacaacaataacatatgtatttgtgtgtcacaaagcaaaacaaacacagaaagttgcaaacaaatgccaaattttagtgcagtaataagcattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28177518 |
gagaacaacaacaataacatatgtatttgtgtgtcacaaagcaaaacaaacacagaaagttgcaaacaaatgccaaattttagtgcagtaataagcattg |
28177617 |
T |
 |
| Q |
101 |
tatagtatagtgatagaaagagaaaaaagaaacactctcagctcaacaacttggtcggaaagttgcaaataaaaaggtttctctttctctctcttccctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28177618 |
tatagtatagtgatagaaagagaaaaaagaaacactctcagctcaacaacttggtcggaaagttgcaaataaaaaggtttctctttctctctcctccctg |
28177717 |
T |
 |
| Q |
201 |
ttgtttttctgttacgacacgtttgattttgctgttattaaggcttttaacatcactttcctttgctttgtagcatcataacataattgactccttaaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28177718 |
ttgtttttctgttacgacacgtttgattttgctgttattaaggcttttaatatcactttcctttgctttgtagcatcataacataattgactccttaaaa |
28177817 |
T |
 |
| Q |
301 |
acatcaag |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
28177818 |
acatcaag |
28177825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University